Review





Similar Products

86
Servicebio Inc universal reverse pcr primer
Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/universal reverse pcr primer/product/Servicebio Inc
Average 86 stars, based on 1 article reviews
universal reverse pcr primer - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

99
tiangen biotech co reverse primer
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
tiangen biotech co primer
Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

86
Biotechnology Information reverse rpa primer sets
Reverse Rpa Primer Sets, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse rpa primer sets/product/Biotechnology Information
Average 86 stars, based on 1 article reviews
reverse rpa primer sets - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre common reverse cag ggt tag tag ggg gtc ac
Primer Chatcre Common Reverse Cag Ggt Tag Tag Ggg Gtc Ac, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer chatcre common reverse cag ggt tag tag ggg gtc ac/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
primer chatcre common reverse cag ggt tag tag ggg gtc ac - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer smo l l mutant reverse ctc cag act gcc ttg gga aaa
Primer Smo L L Mutant Reverse Ctc Cag Act Gcc Ttg Gga Aaa, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer smo l l mutant reverse ctc cag act gcc ttg gga aaa/product/Jackson Laboratory
Average 86 stars, based on 1 article reviews
primer smo l l mutant reverse ctc cag act gcc ttg gga aaa - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Azenta reverse primers
Reverse Primers, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primers/product/Azenta
Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results