Review



reverse primer  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    TaKaRa reverse primer
    Reverse Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1219 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/TaKaRa
    Average 99 stars, based on 1219 article reviews
    reverse primer - by Bioz Stars, 2026-03
    99/100 stars

    Images



    Similar Products

    virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus  (ATCC)
    94
    ATCC virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus
    Virus Forward Primer Reverse Primer Length Bp Rice Dwarf Virus Cgatcccgggaat Tcgga Ccgaattcccggg Atcc 525 Rice Stripe Virus, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus/product/ATCC
    Average 94 stars, based on 1 article reviews
    virus forward primer reverse primer length bp rice dwarf virus cgatcccgggaat tcgga ccgaattcccggg atcc 525 rice stripe virus - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    sivspecific reverse primer  (Thermo Fisher)
    95
    Thermo Fisher sivspecific reverse primer
    Sivspecific Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sivspecific reverse primer/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    sivspecific reverse primer - by Bioz Stars, 2026-03
    95/100 stars
    		  Buy from Supplier
    reverse transcription primers oligo  (Thermo Fisher)
    97
    Thermo Fisher reverse transcription primers oligo
    Reverse Transcription Primers Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcription primers oligo/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    reverse transcription primers oligo - by Bioz Stars, 2026-03
    97/100 stars
    		  Buy from Supplier
    reverse gcgcgggcccacgtagtacggg primers  (New England Biolabs)
    99
    New England Biolabs reverse gcgcgggcccacgtagtacggg primers
    Reverse Gcgcgggcccacgtagtacggg Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse gcgcgggcccacgtagtacggg primers/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    reverse gcgcgggcccacgtagtacggg primers - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    reverse primers  (Toyobo)
    97
    Toyobo reverse primers
    Reverse Primers, supplied by Toyobo, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primers/product/Toyobo
    Average 97 stars, based on 1 article reviews
    reverse primers - by Bioz Stars, 2026-03
    97/100 stars
    		  Buy from Supplier
    reverse primer  (Thermo Fisher)
    96
    Thermo Fisher reverse primer
    Reverse Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    reverse primer - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    1353 reverse hindiii primers  (New England Biolabs)
    99
    New England Biolabs 1353 reverse hindiii primers
    1353 Reverse Hindiii Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1353 reverse hindiii primers/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    1353 reverse hindiii primers - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    reverse primer  (TaKaRa)
    99
    TaKaRa reverse primer
    Reverse Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/TaKaRa
    Average 99 stars, based on 1 article reviews
    reverse primer - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    primer transcript ii reverse transcriptase  (TaKaRa)
    96
    TaKaRa primer transcript ii reverse transcriptase
    Primer Transcript Ii Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer transcript ii reverse transcriptase/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    primer transcript ii reverse transcriptase - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier

    Image Search Results